+1(978)310-4246 credencewriters@gmail.com
  

Drop-in Sessions
Want to discuss concepts from our Online, Workshop or Lab material?
Drop into our Zoom sessions!
Week 2 to Week 12
Tuesday, Wednesday 1:00PM-2:00PM (AEST)
Thursday, 11:00AM-12:00PM (AEST)
Link in each week’s section under ‘Discuss’
Kelly
Karen
Tom
Bevvies with Bio – Thu 18th August, 3:00 PM
• INTEREST ONLY – NOT ASSESSED
•
•
Wondering where biology can take you?
Come along to Bevvies with Bio to hear about:
– biology related careers (from people in that career)
– using biology as a springboard to other vocations (from
people who have taken those pathways)
•
•
Bring along your favourite beverage and have chat with the
First Year Team and their guests
Thursday 18th August, 3 pm, on Zoom – Link will be on
the Week 4 Moodle Page
Week 1
Evolving Life:
Natural selection and the tree of life
Associate Professor Alistair Evans
Warning
This material has been reproduced and communicated to you by or on
behalf of Monash University in accordance with s113P of the Copyright Act
1968 (the Act).
The material in this communication may be subject to copyright under the
Act.
Any further reproduction or communication of this material by you may be
the subject of copyright protection under the Act.
Do not remove this notice.
Weekly Learning Outcomes
• Explain the main requirements for natural selection to occur, and compare with
artificial and sexual selection.
• Describe the biological species concept, its limitations and alternative species
concepts.
• Describe the processes by which new species can form and explain the two
general types of reproductive isolation.
• Describe how to build a phylogenetic tree from shared derived characters.
Weekly Learning Outcomes – This Workshop
• Explain the main requirements for natural selection to occur, and compare with
artificial and sexual selection.
Touch on
• Describe the biological species concept, its limitations and alternative species
concepts.
• Describe the processes by which new species can form and explain the two
general types of reproductive isolation.
• Describe how to build a phylogenetic tree from shared derived characters.
Link to
Next Week’s Learning Outcome
1. Explain how fossils give evidence of past life and how phylogeny and
fossils give independent and corroborating evidence of evolution.
Trees of Life
• Phylogenetic trees show evolutionary relationships of animals and plants
• To build a tree we need:
• Characters, e.g. morphological or molecular
• Method to decide which species are more similar, e.g. parsimony
Activities: Constructing Phylogenetic Trees
During this workshop, we will construct phylogenetic trees in three parts:
In the Part 1, you will build a morphological tree.
In the Part 2, you will build a molecular tree.
In the Part 3, you will classify fossils that have no genetic information.
Part 1: Build a morphological tree
Your group will place 11 animals on the morphological phylogenetic tree.
Use the number of common characters between animals to work out which
species are more closely related to each other.
Place them in the correct positions to represent these relationships on the
morphological tree.
Indicate which characteristic(s) were gained / lost at each branch.
Part 1: The morphological tree
In the morphological character matrix (provided in the Week 1 ‘Apply section’), an
‘X’ indicates that this morphological structure (or character) is found in this animal.
Animal
Characters
#1
#2
#3
#4
#5
#6
#7
#8
Cat (Felis catus)
X
X
X
X
X
X
Chicken (Gallus gallus)
X
Dog (Canis familiaris)
X
X
X
X
X
X
Dolphin (Tursiops truncatus)
X
X
X
X
X
Elephant (Loxodonta africana)
X
X
Gorilla (Gorilla gorilla)
X
X
X
X
Hedgehog (Atelerix albiventris)
X
X
X
X
Human (Homo sapiens)
X
X
X
Lemur (Lemur catta)
X
X
Mouse (Mus musculus)
X
Pig (Sus scrofa)
#9
#10
#11
X
X
X
X
X
X
X
X
X
X
X
X
X
X
Porcupine (Erethizon dorsatum)
X
X
X
X
Rock hyrax (Procavia capensis)
X
X
X
X
X
X
X
X
Part 1: Build a morphological tree
Clue: Look for synapomorphies
Syn
apo
– morphy
Shared derived or new character
• Synapomorphies define monophyletic groups
Plesio
– morphy
Ancestral character
• Plesiomorphies are not useful for reconstructing
phylogenetic trees
Animal
Characters
#1
#2
#3
#4
#5
#6
#7
#8
Cat (Felis catus)
X
X
X
X
X
X
Chicken (Gallus gallus)
X
Dog (Canis familiaris)
X
X
X
X
X
X
Dolphin (Tursiops truncates)
X
X
X
X
X
Elephant (Loxodonta africana)
X
X
Gorilla (Gorilla gorilla)
X
X
X
X
Hedgehog (Atelerix albiventris)
X
X
X
X
Human (Homo sapiens)
X
X
X
Lemur (Lemur catta)
X
X
Mouse (Mus musculus)
X
Pig (Sus scrofa)
#9
#10
#11
X
X
X
X
X
X
X
X
X
X
X
X
X
X
Porcupine (Erethizon dorsatum)
X
X
X
X
Rock hyrax (Procavia capensis)
X
X
X
X
X
X
X
X
1
2
3
4
5
6
Animal
Cat
Chicken
Dog
Dolphin
Elephant
Gorilla
Hedgehog
Human
Lemur
Mouse
Pig
Porcupine
Rock hyrax
#1
X
X
X
X
X
X
X
X
X
X
X
X
X
#2
X
#3
X
#4
X
Characters
#5 #6 #7
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
#8
#9
7
8
9
10
11
#10
#11
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
Form your groups
Click the link below to
access your
worksheet:
https://drive.google.com/drive/folders/1uLmolZvH8xX
eNkMMk6X90Jnj8n1zVVoi?usp=sharing
OR, on Moodle
Slides have been deliberately removed
Which characters are synapomorphies among these animals?
Animal
Characters
#1
#2
#3
#4
#5
#6
#7
#8
Cat (Felis catus)
X
X
X
X
X
X
Chicken (Gallus gallus)
X
Dog (Canis familiaris)
X
X
X
X
X
X
Dolphin (Tursiops truncatus)
X
X
X
X
X
Elephant (Loxodonta africana)
X
X
Gorilla (Gorilla gorilla)
X
X
X
X
Hedgehog (Atelerix albiventris)
X
X
X
X
Human (Homo sapiens)
X
X
X
Lemur (Lemur catta)
X
X
Mouse (Mus musculus)
X
#9
#10
#11
X
X
X
X
X
X
X
X
X
X
X
Pig (Sus scrofa)PollEv.com/bio2020
X
X
X
Porcupine (Erethizon dorsatum)
X
X
X
X
Rock hyrax (Procavia capensis)
X
X
X
X
X
X
X
X
Which characters are synapomorphies among these animals?
Animal
Plesiomorphy
Characters
#1
#2
#3
#4
#5
#6
#7
#8
Cat (Felis catus)
X
X
X
X
X
X
Chicken (Gallus gallus)
X
Dog (Canis familiaris)
X
X
X
X
X
X
Dolphin (Tursiops truncatus)
X
X
X
X
X
Elephant (Loxodonta africana)
X
X
Gorilla (Gorilla gorilla)
X
X
X
X
Hedgehog (Atelerix albiventris)
X
X
X
X
Human (Homo sapiens)
X
X
X
Lemur (Lemur catta)
X
X
Mouse (Mus musculus)
X
#9
#10
#11
Apomorphy
X
X
X
X
X
X
X
X
X
X
X
X
Pig (Sus scrofa)PollEv.com/bio2020
X
X
X
Porcupine (Erethizon dorsatum)
X
X
X
X
Rock hyrax (Procavia capensis)
X
X
X
X
X
X
X
Part 2: Build a molecular tree
This time, as one group, we will build a molecular phylogenetic tree
for the same 13 animals.
In the genetic character matrix (provided in the Week 1 ‘Apply’
section), each number indicates the number of base pair differences
(A, T, G, C) there are in a particular gene, between the species in the
column and the species in the row.
When we construct the molecular tree, we will need to draw all the
branches as well as placing the animals in the correct positions.
Part 2: Build a molecular tree
Constructing molecular trees
Gene X sequences
Organism 1: ATGTGCCATGGTACAACGGCTACTGTGTAA
Organism 2: ATCTGCCTTGGTACAACGGCTACAGTCTAA
Molecular phylogenetic tree
Organism 3: ATGTGCCATGGTACAACGGCTACAGTGTTA
O4
O2
O1
O3
Organism 4: ATGTGACTTGATACATCGGCTGCAGTGTAA
** ** * ** **** ***** * ** * *
2
4
Number of sequence differences between organisms
O1
O2
O3
O4
O1

4
2
6
O2
4

4
6
O3
2
4

6
O4
6
6
6

6
Each number indicates how many
differences there are between
species connected at this node
Animal
Cat
Chicken
Dog
Dolphin
Elephant
Gorilla
Hedgehog
Human
Lemur
Mouse
Pig
Porcupine
Rock
Hyrax
Cat (Felis catus)

25
2
4
15
7
5
7
7
7
4
7
15
Chicken (Gallus gallus)
25

25
25
25
25
25
25
25
25
25
25
25
Dog (Canis familiaris)
2
25

4
15
7
5
7
7
7
4
7
15
Dolphin (Tursiops truncatus)
4
25
4

15
7
5
7
7
7
3
7
15
Elephant (Loxodonta
africana)
15
25
15
15

15
15
15
15
15
15
15
2
Gorilla (Gorilla gorilla)
7
25
7
7
15

7
2
3
4
7
4
15
Hedgehog (Atelerix
albiventris)
5
25
5
5
15
7

7
7
7
5
7
15
Human (Homo sapiens)
7
25
7
7
15
2
7

3
4
7
4
15
Lemur (Lemur catta)
7
25
7
7
15
3
7
3

4
7
4
15
Mouse (Mus musculus)
7
25
7
7
15
4
7
4
4

7
2
15
Pig (Sus scrofa)
4
25
4
3
15
7
5
7
7
7

7
15
7
25
7
7
15
4
7
4
4
2
7

15
15
25
15
15
2
15
15
15
15
15
15
15

Porcupine (Erethizon
dorsatum)
Rock hyrax (Procavia
capensis)
Drag and reshape
Slides have been deliberately removed
Discussion: Comparison of trees
A
B
C
D
E
F
G
H
I
J
K
L
M
Morphological tree
• What differences do you observe?
A
B
Molecular tree
J
G
C
D
E
F
I
H
K
L
M
• What evolutionary pattern(s) could
contribute to these differences?
What are the closest extant relatives of:
Hippopotamus
Diego Delso, Wikimedia Commons
Elephant
And for next week: Humans
Gross, PLoS ONE
Cetaceans (inc. whales, dolphins)
Dugong and Manatee
Pan
Chimpanzee
Bonobo
flickker photos, flickr
US Government
Rennett Stowe and Nataek, Wikimedia Commons
Any supporting evidence other than DNA?
Hippopotamus
The fossil record:
Ambulocetus
Diego Delso, Wikimedia Commons
Cetaceans (inc. whales, dolphins)
Pakicetus
Akrasia25, Wikimedia Commons
flickker photos, flickr
Part 3: Classify fossils
We will now classify three fossil samples.
Using the character matrix of morphological characteristics (provided in the Week 1
‘Apply’ section), we will decide where to place these fossils in the phylogeny.
We will place the images below onto one of our phylogenetic trees.
Little to no genetic evidence can be obtained from fossils, so we rely on morphological characters
Animal
Cat (Felis catus)
Cave bear (Ursus spelaeus)
Chicken (Gallus gallus)
Dog (Canis familiaris)
Dolphin (Tursiops truncatus)
Elephant (Loxodonta africana)
Gorilla (Gorilla gorilla)
Hedgehog (Atelerix albiventris)
Human (Homo sapiens)
Lemur (Lemur catta)
Mouse (Mus musculus)
Pig (Sus scrofa)
Porcupine (Erethizon dorsatum)
Rock hyrax (Procavia capensis)
Sperm whale (Livyatan melvillei)
T-rex (Tyrannosaurus rex)
#1
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
#2
X
X
#3
X
X
#4
X
X
Characters
#5
#6
#7
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
#8
#9
#10
#11
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
Part 3: Classify fossils
Consider: Which tree will you use? Why?
●
Morphological tree
●
Molecular tree
Answer: The molecular tree… using morphological data
Animal
Cat (Felis catus)
Cave bear (Ursus spelaeus)
Chicken (Gallus gallus)
Dog (Canis familiaris)
Dolphin (Tursiops truncatus)
Elephant (Loxodonta africana)
Gorilla (Gorilla gorilla)
Hedgehog (Atelerix albiventris)
Human (Homo sapiens)
Lemur (Lemur catta)
Mouse (Mus musculus)
Pig (Sus scrofa)
Porcupine (Erethizon dorsatum)
Rock hyrax (Procavia capensis)
Sperm whale (Livyatan melvillei)
T-rex (Tyrannosaurus rex)
#1
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
#2
X
X
#3
X
X
#4
X
X
Characters
#5
#6
#7
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
#8
#9
#10
#11
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
Classify fossils: Answer
Lemur catta
– Indicates were you could flip the
order of the animals from this point
and still be correct
Conclusions
• Phylogenetic trees are hypotheses about
evolutionary relationships
• Morphological and molecular trees each have
their advantages and disadvantages
• ‘Total evidence’ trees combine both molecular
and morphological characters so we can include fossils

Purchase answer to see full
attachment

  
error: Content is protected !!