Description
The two images that you must explain are Figures 1 and 4.
At the end of your summary, you must also include a few sentences about what you found the most interesting about the article and what you learned most from this assignment.
You may need to read sources that are cited throughout the paper and look at the supplemental figures, to fully understand this work. You MUST cite any outside references (i.e., any sources other than the Nguyen BMC Biochemistry paper) that you use in the text and have a list of the references at the end. Your reference page may be separate from the one-page limit.
Please limit your essays to one page, double spaced, 12 point Times New Roman font or 11 point Arial font. Your margins should be no smaller than 0.75 inch.
Nguyen et al. BMC Biochemistry
(2018) 19:12
https://doi.org/10.1186/s12858-018-0101-0
METHODOLOGY ARTICLE
Open Access
Soluble expression of recombinant midgut
zymogen (native propeptide) proteases
from the Aedes aegypti Mosquito Utilizing
E. coli as a host
James T. Nguyen, Jonathan Fong, Daniel Fong, Timothy Fong, Rachael M. Lucero, Jamie M. Gallimore,
Olive E. Burata, Kamille Parungao and Alberto A. Rascón Jr*
Abstract
Background: Studying proteins and enzymes involved in important biological processes in the Aedes aegypti
mosquito is limited by the quantity that can be directly isolated from the mosquito. Adding to this difficulty,
digestive enzymes (midgut proteases) involved in metabolizing blood meal proteins require a more oxidizing
environment to allow proper folding of disulfide bonds. Therefore, recombinant techniques to express foreign
proteins in Escherichia coli prove to be effective in producing milligram quantities of the expressed product.
However, with the most commonly used strains having a reducing cytoplasm, soluble expression of recombinant
proteases is hampered. Fortunately, new E. coli strains with a more oxidizing cytoplasm are now available to ensure
proper folding of disulfide bonds.
Results: Utilizing an E. coli strain with a more oxidizing cytoplasm (SHuffle® T7, New England Biolabs) and changes in
bacterial growth temperature has resulted in the soluble expression of the four most abundantly expressed Ae. aegypti
midgut proteases (AaET, AaSPVI, AaSPVII, and AaLT). A previous attempt of solubly expressing the full-length zymogen
forms of these proteases with the leader (signal) sequence and a modified pseudo propeptide with a heterologous
enterokinase cleavage site led to insoluble recombinant protein expression. In combination with the more oxidizing
cytoplasm, and changes in growth temperature, helped improve the solubility of the zymogen (no leader) native
propeptide proteases in E. coli. Furthermore, the approach led to autocatalytic activation of the proteases during
bacterial expression and observable BApNA activity. Different time-points after bacterial growth induction were
tested to determine the time at which the inactive (zymogen) species is observed to transition to the active form.
This helped with the purification and isolation of only the inactive zymogen forms using Nickel affinity.
Conclusions: The difficulty in solubly expressing recombinant proteases in E. coli is caused by the native reducing
cytoplasm. However, with bacterial strains with a more oxidizing cytoplasm, recombinant soluble expression can be
achieved, but only in concert with changes in bacterial growth temperature. The method described herein should
provide a facile starting point to recombinantly expressing Ae. aegypti mosquito proteases or proteins dependent on
disulfide bonds utilizing E. coli as a host.
Keywords: Aedes aegypti, Midgut, Proteases, Zymogen, Soluble expression, Recombinant protein, Escherichia coli,
Disulfide bond/bridge
* Correspondence: alberto.rascon@sjsu.edu
Department of Chemistry, Duncan Hall 612, One Washington Square, San
José State University, San José, CA 95192, USA
© The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Nguyen et al. BMC Biochemistry
(2018) 19:12
Background
The Aedes aegypti mosquito is responsible for the
transmission of the Zika, Dengue, and Yellow Fever flaviviruses, as well as the Chikungunya alphavirus. The
female mosquito may become infected with each virus
upon imbibing a blood meal from an infected human
host. The uptake of a blood meal is required to produce
the necessary nutrients needed for egg production,
without it the mosquito life cycle would cease [1]. Unfortunately, it is this blood meal acquisition step that
allows the transmission of viruses from an infected female mosquito to an uninfected human host. Each viral
infection leads to many common flu-like symptoms like
fever, headache, rash, joint and muscle pain, but in severe cases, hemorrhagic stages and even death can
occur (as is the case with Dengue and Yellow Fever)
[2]. For Chikungunya, infection may lead to long-lasting joint pain that may last several weeks or years [3].
Currently, however, the biggest threat to people around
the world is Zika. Zika viral infection has been directly
linked to microcephaly in newborn babies and linked to
Guillian-Barré syndrome [4], a condition in which the
body’s own immune systems attacks the nerves.
Brazil was the first country in the Americas to report
the presence of Zika in 2015, but transmission has
spread beyond South America, to Mexico and the
United States, with local transmission observed in both
Florida and Texas in the last few years [4, 5]. This rapid
expansion is believed to be due to the feeding behavior
of the Ae. aegypti mosquito, preferring to feed on
humans and preference to live near people in urban
areas, but also to warmer climates creating ideal environmental conditions for the mosquito to thrive [6]. Although vaccines are available to combat the Yellow
Fever virus (YFV-17D) and the Dengue virus (Dengvaxia, CYD-TDV), there are no licensed vaccines available to combat the Zika and Chikungunya viruses [7,
8]. Of the two vaccines, vaccination with YFV-17D and
its sub-strains lead to lifelong immunity, as for Dengvaxia, recent studies have shown that Dengvaxia vaccination has led to severe illness and hospitalizations
on people who have never been exposed to Dengue [9,
10]. Regardless, however, the World Health Organization
still recommends the use of the vaccine in highly endemic
regions [11]. An alternative approach, which is still the
leading approach to combat mosquito-borne viral infections and transmission, is through vector control strategies, with the most common being the use of insecticides
or larvicides [6, 12]. However, the use of organophosphates, pyrethroids, carbamates, and organochlorides to
combat the adult and larval Ae. aegypti are leading to resistance, eventually becoming more ineffective [6]. This
had led to the integration of simultaneous intervention
methods using synthetic insecticides and repellents,
Page 2 of 14
insecticidal nets, sterile insect techniques and transgenic
mosquitoes, which on their own, are not as effective as
the simultaneous use of them [12]. Therefore, there is a
need to explore new and more efficient vector control
strategies.
One potential vector control strategy is to focus on
the digestive enzymes (proteases) involved in the breakdown of blood meal proteins [1, 13–16]. Upon ingestion
of a blood meal, several midgut endo- and exo-proteases
are released at different times during the biphasic blood
meal digestion period [17], which aids in producing
amino acids and oligopeptides needed for egg production and other metabolic processes [1]. It is important to
note, that these proteases are only expressed after a
blood meal has been imbibed, with some proteases being
regulated at the protein translational level [14, 18] and
others at the transcriptional level [19]. In 2009, Isoe et
al. utilized RNAi knockdown studies to functionally
identify candidate midgut proteases responsible for the
breakdown of blood meal proteins in the Ae. aegypti
mosquito. In their findings, knockdown of three abundant midgut proteases (AaSPVI, formerly known as 5G1,
NCBI Accession # GQ398048), AaLT (NCBI Accession
# M77814), AaSPVII (NCBI Accession # GQ398049))
led to a decrease in fecundity compared to FLUC controls [1]. The Ae. aegypti mosquito is highly dependent
on these proteolytic enzymes to achieve maximal fecundity, so targeting the proteases responsible for degrading the major blood meal proteins should inhibit the
production of the necessary nutrients for the egg-laying
process, reducing the mosquito population and leading
to a reduction in viral pathogen transmission. What
makes this process an ideal target is the fact that ~ 80%
of the blood meal is composed of mostly protein and
only a handful of midgut proteases involved to break
these down into necessary amino acid and poly-peptide
nutrients [1].
Mosquito control is key in slowing the spread of
mosquito-borne diseases, especially in areas with high
pathogen transmission. However, before validating midgut proteases as a potential vector control strategy, we
must first fully understand how individual midgut proteases digest blood meal proteins. This involves in vitro
biochemical studies using recombinant technology because one can achieve high levels of an enzyme product
that would otherwise be difficult to isolate, especially if
the source is only available in small quantities [20]. Initial attempts at recombinantly expressing mosquito midgut proteases using Escherichia coli led to insoluble
expression (inclusion bodies), which were isolated and
purified using a denaturation/renaturation strategy [15].
This approach did lead to active recombinant midgut
proteases, but rather than produce recombinant proteases
with the native (wild type) propeptide region, a
Nguyen et al. BMC Biochemistry
(2018) 19:12
heterologous enterokinase cleavage site was engineered to
allow for the activation of the proteases in vitro. With engineering of the SHuffle E. coli strain (New England Biolabs), with a more oxidizing cytoplasm, the four most
abundant proteases were successfully solubly expressed in
a bacterial system. This strain of E. coli has deletions in
thioredoxin reductase (trxb) and glutathione reductase
(gor), proteins that promote a reducing cytoplasm, similarly to Origami cells manufactured by Novagen [21].
However, rather than overexpressing the disulfide bond
isomerase A (DsbA) chaperone (Origami cells), SHuffle
cells overexpress the DsbC periplasmic chaperone in the
cytoplasm, which specifically isomerizes mis-oxidized proteins to their native states, but also results in more soluble
expression compared to periplasmic expression systems
(fully reviewed and explained in [21]). Therefore, here we
describe the cloning and successful recombinant soluble
expression of wild type zymogen (inactive no leader sequence) forms of the most abundant Ae. aegypti mosquito
midgut proteases using SHuffle E. coli cells. The method
described should provide a facile starting point to determine the conditions needed to recombinantly solubly expressing mosquito proteases or other eukaryotic proteins
dependent on disulfide bonds using bacteria as a host.
Methods
The approach to solubly expressing recombinant proteolytic enzymes in E. coli are described for the most
abundant midgut proteases (AaET, NCBI Accession #
X64362), AaSPVI, AaSPVII and AaLT), each dependent
on three disulfide bonds for structure and function.
However, the successful approach described may be applicable to other proteases or proteins dependent on disulfide bond formation.
Chemicals
Reagent grade (or better) Tris Base (2-amino-2-(hydroxymethyl)-1,3-propanediol), calcium chloride, hydrochloric acid, dithiothreitol (DTT), imidazole, isopropylβ-D-thiogalactopyranoside (IPTG), Nα-benzoyl-DL-arginine-4-nitroanilide (BApNA), kanamycin, Luria Broth,
and Terrific Broth were purchased from Fisher Scientific (Thermo Fisher Scientific, Waltham, MA). To
visualize protease expression of bacterial lysates and of
concentrated purified proteases, 4–12% (gradient) or
12% NuPAGEâ„¢ Bis-Tris Protein Gels (Invitrogen, Carlsbad, CA) were used and stained with either InVisionâ„¢
His-Tag In-Gel Stain (Invitrogen #LC6030), SimplyBlueâ„¢ Safe Stain (Invitrogen #LC6065) or both. For
western blots, AaET-specific and other custom antibodies were purchased from GenScript (Piscataway, NJ)
and have been previously described [1, 15].
Page 3 of 14
Cloning and engineering of recombinant DNA plasmid
constructs
Full-length zymogen plasmid constructs with the signal
(leader) sequence were originally cloned into the pET
vector system (Novagen, Madison, WI), as described in
[15]. However, for the purpose of this study, the leader
sequence in each of the proteases was removed. SignalP
4.1 [22] was used to identify the leader sequence and
primers were designed for cloning of the no leader
zymogen mosquito midgut proteases (Table 1) (from
here on, proteases without the leader (no leader proteases) will be referred as NL, e.g., AaET-NL). Primers
with the NdeI and HindIII restriction cleavage sites were
included for cloning of AaET-NL, AaSPVI-NL, and
AaSPVII-NL into the pET28a vector (Novagen #69864–
3), while NdeI and XhoI sites were included for
AaLT-NL. The mosquito protease genes of interest were
PCR amplified using the GoTaq® Green Master Mix
(Promega #M7122, Madison, WI), following the manufacturer’s protocol. Once engineered, plasmid constructs
were verified by DNA sequencing (ELIM Biopharmaceuticals, Inc., Hayward, CA).
Expression of recombinant proteases using SHuffle® (NEB)
E. coli cells and Bis-Tris gel analysis
The most commonly used bacterial strain for expression
of genes cloned into the pET vector system are the
BL21(DE3) and E. coli K12 lineage strains [20]. These
strains are the go to strains for initial screening and to
ensure that the bacterial host can express the eukaryotic
gene of interest. The problem however, is that these
strains have a reducing cytoplasm caused by the activities of thioredoxin reductase and glutathione reductase
[23]. Because of this, the initial attempt at solubly expressing the four abundant midgut proteases failed leading to insoluble expression (inclusion bodies) [15]. The
disulfide bridges in these proteases were unable to form
(all proteases in this study depend on three disulfide
bonds for structure and function), therefore destabilizing
the enzymes and promoting aggregation. To overcome
this, we turned to a BL21(DE3) derivative known as
SHuffle® T7 Express Competent E. coli (New England
Biolabs #C3029J, Ipswich, MA). Plasmid constructs (25
to 50 ng pDNA) were transformed following the manufacturer’s protocol. For small or large-scale growth expression, a single colony from transformed overnight
plates was selected to set overnight liquid cultures in LB
media supplemented with kanamycin (30 μg/ml) and set
in a 30 °C shaker (250 rpm) for 16 to 18 h. The optical
density at 600 nm (OD600nm) of the overnight cultures
was determined using a spectrophotometer and used as
the starter culture to initiate growth at a starting
OD600nm ~ 0.05 in fresh, autoclaved media. We have
found success utilizing Terrific Broth (TB) as the main
Nguyen et al. BMC Biochemistry
(2018) 19:12
Page 4 of 14
Table 1 Primers designed and used for PCR amplification and cloning of zymogen (no leader) Ae. aegypti mosquito midgut proteases.
Primers were purchased from ELIM Biopharmaceuticals, Inc. The melting temperature (TM) of the primer sequence that anneals to the
gene of interest was estimated using NetPrimer (Premier Biosoft, Palo Alto, CA). The restriction enzyme used for each primer are
underlined and in bold
Protease
Primer
Primer Sequence
TM (°C)
AaET
AaET-Zym-pET-Fwd
5’-AAAAACATATGGCAACGCTGTCCAGCGGTC-3’
64.55
AaET
AaET-Zym-pET-Rev
5’-AAAAAAAGCTTATTAAACCTCGGAAACCTCTCGGA-3’
64.24
AaSPVI
AaSPVI-No Leader-Fwd
5′ –AAAAACATATGGCTTCAACCGGTGGTTTGC– 3’
61.1
AaSPVI
AaSPVI-Zym-pET-Rev
5′ –AAAAAAAGCTTATTACAATCCACTGACCTCCTGG– 3’
59.09
AaSPVII
AaSPVII-Zym-pET-Fwd
5’-AAAAACATATGCTATCAACCGGATTCCATCCGC-3’
65.36
AaSPVII
AaSPVII-Zym-pET-Rev
5’-AAAAAAAGCTTATTAAACTCCACTGACTTCCGCCA-3’
63.72
AaLT
AaLT-Zym-pET-Fwd
5’-AAAAACATATGTTCCCATCGTTGGACAACG-3’
59.59
AaLT
AaLT-Zym-pET-Rev
5’-AAAAACTCGAGTTATTACAGTCCAGTCTTCTGCTTGA-3’
57.11
growth media for all growth experiments, but any rich
media containing extra carbon sources should suffice.
All growths were then set in a 30 °C shaker (250 rpm)
and the OD600nm monitored until reaching an OD600nm
~ 0.5–1.0 (middle of the log phase of bacterial growth).
Once the density of the bacterial cells reached the
proper OD600nm, the cells were induced with 0.1 mM
IPTG (this concentration of IPTG was utilized based on
the findings in [21]). However, different post-induction
growth temperatures were tested in order to produce
soluble recombinant proteases. Initial growth experiments utilized the manufacturer’s recommended 30 °C
post-induction temperature, but in subsequent growth
experiments, lower temperatures (23 °C, 15 °C, and 10 °
C) were tested [21]. All growth experiments were grown
to reach an OD600nm ~ 0.5–1.0 at 30 °C, but before induction and growth at the lower temperatures, the
growths were cooled on ice for 5 min, then induced and
set at the respective lower post-induction temperature.
Specifically, for AaET-NL and AaSPVII-NL, soluble expression was observed when cells grown at 23 °C and 15
°C (250 rpm) after induction with IPTG. As for AaSPVINL and AaLT-NL, soluble expression resulted when cells
grown at 15 °C and 10 °C (250 rpm). Each growth experiment was repeated independently a minimum of three
times. A no induction control was set as described above
for AaET, AaSPVI, and AaSPVII, grown at 30 °C, set on
ice when cells reached an OD600nm ~ 0.5–1.0, and grown
at 15 °C.
SDS-PAGE analysis was utilized to detect protease
expression of 1 ml samples collected at pre- and postinduction (time points varied depending on the
temperature). The 1 ml samples collected were centrifuged (full speed for 3 min at 4 °C on a tabletop centrifuge), supernatant discarded, and pellets stored at − 20 °
C until use. Each pellet was solubilized in 20 mM
Tris-HCl, pH 7.2, and sonicated at 25% amplification
for 10 s each (total of three cycles) on ice utilizing a
micro-tip cell disruptor (Fisher Model 505 Sonic Dismembrator). A total protein sample (0.02 ml) was collected before centrifugation, then centrifuged at 13,000
rpm (4 °C) for 5 min. Once centrifuged, a 0.02 ml soluble (supernatant) sample was collected. All samples
were treated with 6x SDS sample buffer and denatured
at 95 °C for 4 min. Samples were loaded on to 4–12% or
12% Bis-Tris gels in the presence of prestained PageRulerâ„¢ protein ladder (Thermo Scientific #26616 or
#26619), followed by staining with InVisionâ„¢ His-Tag
In-Gel Stain and/or SimplyBlueâ„¢ Safe Stain. For lowlevel detection and identification of AaET, an AaETspecific antibody was used and the western blot protocol described in Rascon et al. [15] was followed.
In vitro BApNA activity assays of bacterial crude lysates
For detection of trypsin-like activity, BApNA was used as
the synthetic chromogenic substrate, as described in [15].
However, the final reaction conditions used were 20 mM
TRIS-HCl pH 7.2 + 10 mM CaCl2, 1 mM BApNA, and
20 μl of soluble pre- and post-induction crude lysates
collected from the growth experiments (1 ml total reaction volume). As a control, non-induced bacterial crude
lysates were set as described. Each assay was repeated
independently a minimum of three times and plotted
using GraphPad Prism software (mean values ± SEM).
Purification of Solubly expressed recombinant midgut
proteases
With the success of solubly expressing recombinant
midgut proteases, we proceeded to FPLC purify AaSPVIINL and AaLT-NL using a 5 ml HisTRAP FF Nickel column (GE HealthCare #17–5255-01, Chicago, IL) on an
AKTA Pure L1 Chromatography System (GE HealthCare). For purification, cell paste was solubilized in
ice-cold 20 mM TRIS-HCl, pH 7.2 + 250 mM NaCl + 10
mM Imidazole + 2 mM DTT (Buffer A) (1 g frozen cell
paste per 5 ml buffer ratio). The lysate was then
Nguyen et al. BMC Biochemistry
(2018) 19:12
sonicated at 35% amplification for 15 min on ice (15 s
on/30 s off cycles), followed by centrifugation at 16,000
rpm (4 °C) for 35 min. The clear crude lysate was loaded
on to an equilibrated HisTRAP Nickel column and washed
with 10 column volumes (CV) of Buffer A, followed by a
three-step linear elution gradient (10%B for 3 CV, 30%B for
6 CV, 50%B for 5 CV) with 20 mM TRIS-HCl, pH 7.2 +
250 mM NaCl + 500 mM Imidazole + 2 mM DTT (Buffer
B). Fractions (1.5 ml each) containing the protease of interest were collected (detected by protein gel analysis) and
pooled together. The pooled purified fractions were
then dialyzed in 2 L 50 mM Sodium Acetate pH 5.2 +
2 mM DTT (twice) at 4 °C to remove excess imidazole
and NaCl. The next day, the dialyzed protease was
concentrated using an Amicon Ultra-15 Centrifugal
Filter (10 kDa NMWL) (Millipore Sigma #UFC901024,
St. Louis, MO), following the manufacturer’s protocol.
The final concentrated protease was aliquoted, flash
frozen in liquid nitrogen, and stored at − 80 °C. The
concentration of the protease was estimated using the
Pierceâ„¢ BCA Protein Assay Kit (Thermo Fisher
#23227). As a final step, different quantities of protease were loaded on to a Bis-Tris protein gel in order
to visualize excess contaminants. We are currently in
the process of purifying AaET-NL and AaSPVI-NL.
Results
In attempting to recombinantly express any protein
or enzyme, E. coli is the first and most convenient
host organism to use. There are several review articles that focus on overcoming difficulties in recombinant protein expression, as well as optimizing the
conditions to improving the solubility of recombinantly expressed protein (see [20, 24, 25]). Of the
many suggestions offered, the five that can easily be
modified are the type of bacterial cells, type of specific vectors with fusion tags, type of rich media to
use, IPTG concentration, and the temperature at
which cells are grown. In attempting to recombinantly
express eukaryotic proteases in bacteria, all of these
factors come in to play to ensure the expression of
active, soluble proteases. However, we have found that
expression of the zymogen form of Ae. aegypti midgut
proteases prove to be no problem when using the
BL21(DE3) or Rosetta2(DE3) cell strains [15]. The
bacterial cells are not affected by the expression of
the proteases and leads to high concentrations, but as
insoluble inclusion bodies. The proteases require
three disulfide bonds for structure and function, and
with a reducing cytoplasm, proper disulfide bond formation is difficult. Therefore, we focused on SHuffle®
T7 E. coli cells with a more oxidizing cytoplasm and
bacterial growth temperature to solubly express the
Ae. aegypti midgut proteases.
Page 5 of 14
Soluble expression of zymogen (native propeptide)
midgut proteases without the leader sequence
At the time of initial cloning and expression of fulllength Ae. aegypti midgut zymogen proteases with the
leader (signal) sequence [15], specially designed bacterial
cells with a more oxidizing cytoplasm were not as commercially available and limited. Therefore, the attempts
of expressing soluble proteases were hampered due to
lack of properly oxidized disulfide bond formation. A
few years ago, new bacterial cells (SHuffle® T7, NEB)
with a more oxidizing cytoplasm, along with the expression of a disulfide bond isomerase (DsbC), a protein that
aids in correcting the folding of mis-oxidized disulfide
bonds, became available [21]. These SHuffle® cells are a
bit superior compared to Origami (Novagen) because
DsbC does not oxidize just any available cysteine residue, only those mis-oxidized proteins that have the core
hydrophobic residues exposed are targeted [21]. Furthermore, amino acid sequence analysis and literature search
revealed that the leader (signal) sequence in eukaryotic
proteins, which is fairly hydrophobic, could lead to aggregation upon expression in bacteria [26]. To overcome
these issues, we engineered the no leader (signal) sequence
zymogen plasmid constructs of AaET, AaSPVI, AaSPVII,
and AaLT (Fig. 1), then transformed into SHuffle® T7 cells
and grown in TB media at various temperatures.
To express the gene of interest, the manufacturer suggests a starting temperature of 30 °C, which is lower than
the ideal E. coli growth conditions of 37 °C. This is due to
the sensitivity of SHuffle® T7 cells to temperature, which
is caused by deletions in trxb and gor [21]. Therefore, NL
midgut protease expression started at 30 °C and induction
with 0.1 mM IPTG. Initial soluble expression attempts at
this temperature and IPTG concentration led to insoluble
expression, as seen in Fig. 2. However, since the goal is to
produce soluble proteases, in reading the literature [20,
24, 25], and recommendations from the manufacturer
[21], the next condition altered to improve solubility was
temperature. It is important to note, that the conditions to
solubly expressing Ae. aegypti midgut proteases were
investigated separately and determined to vary among
the four different proteases. Caution should be taken
when investigating the best conditions to solubly express eukaryotic proteases and change a single variable
at a time. Hence, for these studies temperature was the
next obvious step, and we have determined the optimal
bacterial growth temperature conditions that led to the
best soluble expression of each mosquito protease. For all
growths, Terrific Broth and an initial growth temperature
(pre-induction) at 30 °C were used to reach an OD600nm ~
0.5–1.0. This was done to ensure a lag to mid-log phase of
3.5 h. If grown at a lower (colder) temperature before induction, the log phase would take longer to achieve. Once
the proper optical density observed, the bacterial growth
Nguyen et al. BMC Biochemistry
(2018) 19:12
Page 6 of 14
Fig. 1 Amino acid sequences of Ae. aegypti midgut zymogen (no leader) proteases. In order to improve solubility of recombinant proteases, the
leader (signal) sequence was removed to produce the no leader zymogen as shown. Since the genes were cloned into the pET28a
vector (utilizing the NdeI restriction site, CATATG), the resulting recombinant proteases will contain an N-terminal Methionine (shown in
red), as well as the his6-tag linker (MGSSHHHHHHSSGLVPRGSH) upstream of the Met group (shown in red). The arrow points to the
propeptide cleavage site required to activate the zymogen to the active mature protease
temperatures were reduced (post-induction). The first
temperature attempted was 23 °C, and as shown in Fig. 3a,
the soluble expression of AaET-NL zymogen was observed
between one to 2 h post-induction. Interestingly, under
the conditions tested, the enzyme seems to auto-catalyze
converting the inactive zymogen to the active mature form
of the enzyme. In the western blot shown, an AaET-specific antibody was utilized to detect the expression of the
protease of interest leading to the observation of two
bands. BApNA activity was tested, but no activity
Fig. 2 Initial attempt at solubly expressing recombinant midgut proteases in SHuffle® T7 Express Competent E. coli cells (NEB). For each growth
experiment, TB media and a 30 °C growth temperature was used. Cells were induced with 0.1 mM IPTG when reaching the log phase (OD600nm ~
0.5–1.0). Samples were collected at the given time points (in hours) and prepared for SDS-PAGE analysis. The MW ladder is in kilo-Daltons (kDa).
In all cases, the arrow indicates where the expected soluble over-expressed protease should appear. However, all proteases under these conditions
were expressed insolubly, only observed in the total samples. a 4–12% BIS-TRIS gel over-expression of AaET grown for a total of 26 h. The MW of the
his6-tagged AaET-NL zymogen is ~ 27.0 kDa. b 12% BIS-TRIS gel over-expression of AaSPVI grown for a total of 4 h. The MW of the his6-tagged AaSPVINL zymogen is ~ 28.7 kDa. c 12% BIS-TRIS gel over-expression of AaSPVII grown for a total of 4 h. The MW of the his6-tagged AaSPVII-NL zymogen is ~
28.7 kDa. d 12% BIS-TRIS gel over-expression of AaLT grown for a total of 4 h. The MW of the his6-tagged AaLT-NL zymogen is ~ 27.6 kDa
Nguyen et al. BMC Biochemistry
(2018) 19:12
Fig. 3 Soluble expression of recombinant AaET-NL and AaSPVII-NL
zymogen proteases grown in TB media at 23 °C post-induction
(induced with 0.1 mM IPTG). Plasmid constructs were transformed
into SHuffle® T7 Express Competent E. coli cells (NEB). The MW
ladder is in kilo-Daltons (kDa). a Western blot analysis utilizing an
AaET-specific antibody of soluble samples collected from the
growth and expression of AaET (a total of 4 h post-induction). The
zymogen (inactive form of the protease) is observed in the first 2 h
(MW ~ 27.0 kDa, red arrow), but a second species hypothesized to
be the active mature form begins to appear at the two-hour timepoint (MW ~ 22.4 kDa, green arrow) while the zymogen completely
disappears by the third hour post-induction. b Large scale expression
analysis of AaSPVII-zymogen grown for a total of 5 h post-induction. A
single band at ~ 28.7 kDa (orange arrow) is observed to be increasing
over time after induction with no observable band present in both the
total and soluble pre-induction samples (t = 0 h)
observed. Another protease that expressed solubly at
23 °C was AaSPVII (Fig. 3b). Unlike AaET, AaSPVII is
optimally solubly expressed within 5 h post-induction
with 0.1 mM IPTG and only a single band is observed.
As for AaSPVI-NL and AaLT-NL, expression at 23 °C
resulted in insoluble expression similar to the results in
Fig. 2. Therefore, we attempted to grow the cells and express the proteases (including AaET-NL and AaSPVIINL) at 15 °C (post-induction). The lower temperature
slows down bacterial metabolism and the transcriptional/translational machinery, so longer incubation
times are required to express the proteins of interest
[21, 25, 27, 28]. For AaET-NL, samples were collected up to 26 h (post-induction), for AaSPVI-NL to
72 h, and for AaSPVII-NL 28 h. Surprisingly, all three
proteases were expressed solubly but with the appearance of a second band over time, similar to the
23 °C expression of AaET-NL (Fig. 3a). We hypothesized that the second band might be the active form
Page 7 of 14
of each protease, and to test this, we utilized
BApNA. Purified AaET, AaSPVI, and AaSPVII have
been shown to proteolytically cleave BApNA releasing the p-nitroanilide chromophore [15]. Soluble
crude lysates (20 μl) at pre- and post-induction samples were tested for BApNA activity, and simultaneously analyzed by SDS-PAGE. As seen in Fig. 4a, the
zymogen form of AaET-NL is solubly expressed (as
indicated by the yellow arrow) and begins to disappear at 5 h (post-induction) and a new more pronounced band begins to appear (purple arrow), which
correlates with increasing BApNA activity. BApNA activity of AaET crude lysates is not observed until the 5 h
time-point, reaching maximal activity at 24 h post-induction. For AaSPVI-NL, soluble expression is not observed until 16 h post-induction, with strong
visualization of the active form (purple arrow) beginning at 24 h post-induction (Fig. 4b). BApNA activity is
also observed, but delayed compared to AaET, starting
at 16 h, followed by maximal activity at 67 h, and loss of
activity at 72 h post-induction. Unlike AaSPVI-NL, soluble expression for AaSPVII-NL is observed at 4 h, with
the active species appearing at 15 h post-induction,
which correlates with detectable BApNA activity (Fig.
4c). Interestingly, an intermediate species (between the
zymogen (yellow arrow) and the active form (purple
arrow)) appears at 8 h, becomes the most prominent
band at 10 h, and disappears at 15 h (gel in Fig. 4c).
There is no detectable BApNA activity observed at
these time-points, indicating an inactive zymogen species. There is a possibility that this protease may be
cleaving at the Arg position in the thrombin cleavage
site (LVPRGS) (see Fig. 1), before activating to the mature form. Work is currently underway to determine
this intermediate species.
With the successful expression of AaET-NL,
AaSPVI-NL, and AaSPVII-NL at 15 °C, we decided
not to repeat the growths at 10 °C. However, given
that AaLT-NL was not solubly expressed at the above
temperatures, 10 °C growth experiments were set, successfully producing solubly expressed protease (Fig. 5).
For these experiments, InVisionâ„¢ His-Tag In-Gel Stain
was utilized to visualize the presence of the his6-tagged
AaLT-NL protease. The colder temperature results in
lower overall cell density and protease expression, see
[21, 25, 27, 28], therefore the stain was useful in visualizing and confirming the presence of AaLT-NL. As
shown in Fig. 5, soluble expression was observed at
19 h post-induction with maximal soluble expression
observed at 48 h. Under these conditions, only a single band was observed. BApNA activity assays were
not used since the protease does not to cleave
BApNA in vitro and its protease specificity is currently unknown [15].
Nguyen et al. BMC Biochemistry
(2018) 19:12
Page 8 of 14
Fig. 4 SDS-PAGE analysis and BApNA activity assays of samples collected from small-scale growth experiments of SHuffle® E. coli cells (NEB)
grown in TB media at 15 °C (induced with 0.1 mM IPTG). Samples were collected at the given time points (in hours). The MW ladder is in kiloDaltons (kDa). a The gel represents the soluble expression of AaET-NL zymogen (MW ~ 27.0 kDa, yellow arrow), auto-activating to the active
mature form (MW ~ 22.4 kDa, purple arrow). The presence of active AaET at 5 h post-induction correlates with an increase in BApNA activity,
with maximal activity observed at the 24 h time-point (plot on the right). b The gel represents the soluble expression of AaSPVI-NL zymogen
(MW ~ 28.7 kDa, yellow arrow), auto-activating to the active mature form (MW ~ 24.1 kDa, purple arrow). The presence of active AaSPVI at 16 h
post-induction correlates with an increase in BApNA activity, with maximal activity observed at the 67 h time-point (plot on the right). c The
gel represents the soluble expression of AaSPVII-NL zymogen (MW ~ 28.7 kDa, yellow arrow), auto-activating to the active mature form
(MW ~ 24.2 kDa, purple arrow). The presence of active AaSPVII at 15 h post-induction correlates with an increase in BApNA activity, with
maximal activity observed at the 18 h time-point (plot on the right). Unlike AaET and AaSPVI, AaSPVII expression results in a species that
lies between the zymogen and active forms starting at 8 h post-induction and disappearing at 15 h. This species is an inactive form of
AaSPVII since no detectable BApNA activity observed
Purification of Solubly expressed AaSPVII and AaLT
zymogen (native propeptide) proteases
With the successful soluble recombinant expression of
the most abundant mosquito midgut proteases, and for
the purpose of this study, we focused on the Nickel purification of AaSPVII and AaLT, two proteases expressed
at different temperatures. The activation of mosquito
midgut proteases is unknown and has been hypothesized
that the zymogens might be auto-catalytic [29], see also
Fig. 4. Therefore, to avoid potential activation of the proteases during clear lysate preparation and purification, the
reducing agent dithiothreitol (DTT) was added to all
buffers at a concentration between 1 to 2 mM. All buffers
were kept on ice and purified using the FPLC, which
Nguyen et al. BMC Biochemistry
(2018) 19:12
Page 9 of 14
Fig. 5 Large-scale soluble expression of recombinant AaLT-NL zymogen protease grown in TB media at 10 °C (induced with 0.1 mM IPTG).
Plasmid construct was transformed into SHuffle® T7 Express Competent E. coli cells (NEB). Samples were collected at the given time
points (in hours). The MW ladder is in kilo-Daltons (kDa). Gel analysis of samples collected from the growth of AaLT was first visualized
using InVisionâ„¢ His-Tag In-Gel Stain (Invitrogen), which specifically chelates to and enhances the fluorescence of poly his-tagged proteins
(top figure). The His-Tag stain is the positive identification that the bands expressed in the gel below are indeed the expression of
soluble AaLT-zymogen (MW ~ 27.6 kDa, red arrows). The growth was extended beyond 24 h due to the 10 °C growth conditions, which
helped in solubly expressing the protease, but also to increase bacterial cell density in order to obtain a large quantity of cell paste
for purification
facilitated fraction collection of the protease of interest.
Immediately after identifying the protease fractions, all
were pooled and dialyzed in Sodium Acetate buffer pH 5.2
in order to avoid unexpected potential auto-activation.
Trypsins have been shown to auto-activate at pH 7.0 [30,
31], which is close to the purification buffer conditions
used. This approach proved to be successful because, as
seen in Fig. 6, a single band is observed in the single-step
Nickel purification of both AaSPVII and AaLT. This is the
final gel after purification, pooling of fractions, buffer exchange dialysis, and protease concentration. Very little
contaminates are observed in each gel, but the proteases
can be further purified and optimized using either ion exchange or hydrophobic interaction chromatography.
Discussion
The necessary blood feeding behavior of the Ae. aegypti
mosquito facilitates the transmission of potentially
deadly and harmful viruses to uninfected human hosts.
Zika, Dengue, Yellow Fever, and Chikungunya are
mosquito-borne viral diseases that have become or are
becoming a global health concern [4]. At the moment,
there are no treatments, limited vaccines or therapeutics available to combat these mosquito-borne viral infections, which have led to high endemics and epidemics
observed over the past few years [32]. Therefore, the only
effective strategy still remains to be vector control, and
with Ae. aegypti resistance to chemical compounds and effects to other insect species, new and more effective strategies are needed. A potential strategy may be to focus on
blood meal digestion and the proteases involved in this
process [1, 13–16]. With knockdown studies on three
midgut proteases (AaSPVI, AaSPVII and AaLT) leading to
a decrease in fecundity [1], may provide a potentially new
vector control strategy. However, for this to be realized, in
vitro biochemical studies focusing on midgut proteases
must first be conducted. Even then, producing soluble recombinant mosquito proteases must first be achieved before these studies can be initiated.
Initial work to recombinantly express the zymogen
(inactive) and mature (active) Ae. aegypti midgut proteases led to insoluble expression [15]. Furthermore, due
to unknown activation of the midgut proteases, a strategy using a pseudo propeptide region with an unnatural
enterokinase sequence was developed in order to facilitate activation of the proteases in vitro. To rescue the
enzymes from inclusion bodies, a denaturation/renaturation scheme was developed [15]. Although this approach was successful in isolating bona fide active
midgut proteases for initial enzyme kinetic analysis, the
process is tedious and time consuming, and may not
lead to yields comparable to proteins that can be
Nguyen et al. BMC Biochemistry
(2018) 19:12
Page 10 of 14
Fig. 6 Final gel of Nickel purified recombinant zymogen (no leader) proteases grown and expressed at either 23 °C or 10 °C. In order to demonstrate
that inactive zymogen proteases (with intact N-terminal his6-tag) can be isolated, AaSPVII grown at 23 °C (a) and AaLT grown at 10 °C (b) were purified.
These samples are the post-dialysis concentrate of AaSPVI-NL and AaLT-NL dialyzed in 50 mM Sodium Acetate pH 5.2 + 2 mM DTT (buffer exchanged
twice and set at 4 °C). Samples loaded on the gel are in micrograms (μg) and are increasing in order to show that the single step purification scheme
led to a near homogenous sample with very little contaminants
solubly expressed [33]. In addition, the mode of activation of each zymogen is still unknown because the native propeptide region was removed [15]. Therefore, the
purpose of this work is to describe the approach taken
to recombinantly and solubly express the zymogen
AaET, AaSPVI, AaSPVII, and AaLT midgut proteases
with the native propeptide region using E. coli as the
host. This will provide a much faster and facile starting
point to researchers who have difficulty in producing
solubly recombinant mosquito proteases in E. coli.
The field of Biochemistry has been revolutionized by
the success of producing recombinant proteins using
bacteria [20]. Without the molecular techniques, vast
commercially available expression vectors, engineered
bacterial strains, and rich media cultivation methods,
large amounts of blood fed Ae. aegypti mosquitoes
would be required to isolate midgut proteases that are
only present once a mosquito has imbibed a blood meal
[1, 15]. Because of the ease of manipulation, growth,
and for institutions with limited funding, the cost effectiveness of recombinantly expressing proteins using
E. coli, has made this organism the most widely preferred [24, 34]. Of course, there are limitations to
recombinantly expressing proteins in E. coli (such as
low expression, protein aggregation, plasmid instability,
and protein degradation), but for each case there are
available published troubleshooting strategies that address each potential problem (see [20, 24, 34]). As such,
every protein to be recombinantly expressed will have
its own problems and must be individually optimized to
ensure the production of soluble and active protein. For
the production of the most abundant zymogen midgut
proteases, we have taken the troubleshooting ideas described in several review articles and highlight the most
important parameters required to successfully producing soluble proteases using E. coli, which as we found
were the type of bacterial cells and bacterial growth
and induction temperature.
A major issue when attempting to recombinantly express eukaryotic proteins in bacteria is aggregation, especially proteases dependent on disulfide bridge formation
for structure, stability, and function. Amino acid sequence analysis on AaET, AaSPVI, AaSPVII, and AaLT
revealed the presence of six cysteine residues, which are
predicted to form three disulfide bridges in each protease. It was not surprising that expression of these proteases in BL21(DE3) and Rosetta(DE3) bacterial strains led
to insoluble protein (inclusion bodies) [15]. The cytoplasm of these E. coli strains are highly reducing and the
reducing environment is caused by the thioredoxin and
the glutathione/glutaredoxin reductase pathways, reducing disulfide bonds in proteases leading to misfolding
[20, 33]. Furthermore, the initial attempt at expressing
the zymogen midgut proteases included the protein
leader (signal) sequence [15], a portion of amino acids
on the N-terminus of the protein that is recognized and
targeted to the endoplasmic reticulum for secretion into
the cytoplasm. The problem, however, is that this polypeptide is usually hydrophobic in nature and has been
shown to cause protein aggregation, thermodynamically
destabilizing the recombinant expression of the protein
of interest in E. coli [26]. To circumvent this issue, the
signal sequence of each midgut protease was removed
using PCR, keeping only the natural propeptide region
Nguyen et al. BMC Biochemistry
(2018) 19:12
(Fig. 1). This was a similar approach taken in the 2011
study where the signal sequence was removed when the
unnatural EK site was introduced into the recombinant
midgut proteases [15].
In order to avoid solubility expression issues resulting
from improper disulfide bond formation, we turned to
SHuffle® T7 Competent E. coli cells (NEB) [21]. These
cells are BL21(DE3) derivatives that carry mutations in
the reductase pathways (thioredoxin and glutathione/
glutaredoxin) leading to a more oxidizing cytoplasm,
which should allow formation of disulfide bridges [21].
In addition, the cells are engineered to constitutively express a disulfide bond isomerase (DsbC), a protein that
aids in correcting of mis-oxidized disulfide bonds. Although the cytoplasmic conditions are ideal for promoting disulfide bridge formation, expression of the midgut
proteases still led to insoluble expression when grown at
the recommended 30 °C temperature. This was observed
for all protease as seen in Fig. 2. This 30 °C temperature
is 7 °C lower compared to wild type E. coli, BL21(DE3),
and other closely related strains. Regardless, whether
using BL21(DE3) or its derivatives, including SHuffle® T7
cells, when attempting to express eukaryotic proteins in a
prokaryotic system there is a chance that at the optimal
temperature, the eukaryotic proteins may be expressed insolubly. Because transcription and translation happen simultaneously in the bacterial cytoplasm, the rate of protein
synthesis is approximately ten times faster than that of a
eukaryotic cell [33]. And since a eukaryotic protein is being synthesized in a foreign prokaryotic environment, the
rate of folding of the recombinantly expressed protease is
not ideal. Prokaryotic proteins tend to fold at a much faster rate than their eukaryotic counterparts at the optimal
growth conditions, and with the combination of a speedy
rate of synthesis and slow folding in recombinant bacterial
expression, the eukaryotic protein could aggregate and be
insolubly expressed [35]. This provides a plausible explanation for why the midgut proteases were expressed insolubly at 30 °C in cells with a more oxidizing cytoplasm. To
overcome this problem, we tested lower temperatures
starting at 23 °C and going as low as 10 °C. Successful soluble expression was observed for AaET-NL and AaSPVIINL at 23 °C (Fig. 3), but no soluble expression was observed for AaSPVI-NL and AaLT-NL. Interestingly, a second band was observed for AaET, which we hypothesized
to be the active mature form. We attempted BApNA activity assays of the crude lysates, but since expression was
only successfully visualized using WB, not enough solubly
expressed AaET was present and could not reach the
lower level of detection of p-nitroanilide formation (>
0.0125 abs units) [15].
The lower temperatures attempted (23 °C, 15 °C, and 10
°C) resulted in the soluble expression of all proteases
(Figs. 3, 4 and 5). However, the preferred temperature
Page 11 of 14
differed for each. For example, AaLT-NL was only solubly
expressed at 10 °C, while all the other proteases were solubly expressed at 15 °C. Importantly, at this temperature we
were able to observe the possible auto-activation of
AaET-NL, AaSPVI-NL, and AaSPVII-NL (Fig. 4). In each
case, the presence of the active species (based on BApNA
activity assays) seems to be dependent on protease concentration, which has been true for bovine and porcine
trypsinogen [36]. In general, after induction with IPTG,
protein expression concentration increases linearly with
time at early time-points, but may reach a point where
the expression is constant. This is the case for the midgut proteases. Expression of the zymogen form is initially
observed, but over time, as expression concentration increases, leads to activation of the protease as observed in
Fig. 4. At the moment, it is unknown if any proteases or
enzymes in the bacterial crude lysates may be activating
the recombinant midgut proteases, but the no induction
growth experiment samples have no detectable BApNA
activity (Additional files 1, 2 and 3: Figures S1, S2 and S3).
Work is currently underway to determine if the midgut
proteases are autocatalytic or if enzymes in the bacterial
lysate are aiding in the process. Nonetheless, the reduced
and colder temperature at which the proteases were
expressed helped with promoting proper folding. By dropping the temperature at induction, the rate of protein synthesis, as well as the temperature-dependent hydrophobic
interactions involved in protein folding are reduced, increasing the chances of proper folding when utilizing E.
coli [37]. This temperature reduction approach led to successfully solubly expressing the four-zymogen (no leader)
midgut proteases. It is important to note that caution
should be taken when dropping the temperature lower
than necessary because traditional promoter systems,
bacterial transcription and translational machinery, and
chaperones may not be as efficient compared to the optimal E. coli growth temperatures (37 °C or in the case
of the SHuffle® cells, 30 °C) [20, 37]. Nonetheless, lowering the temperature at which recombinant proteases
are expressed should be strongly considered before manipulation of any other variable.
Due to the length of time needed to solubly express
the proteases of interest, we utilized Terrific Broth for
all of our experiments. TB media contains yeast extract
and tryptone at higher concentrations compared to LB,
glycerol (an extra carbon source), and phosphate salts to
help with culture acidification, making this much superior than LB [20]. In addition, the cell densities of the
bacterial growths in TB are typically much higher compared to LB, which is important because the lower temperatures lead to a reduction in bacterial metabolism
[25, 27, 28]. For each growth, the bacterial cells were
grown at 30 °C to reach the proper induction at OD600nm
~ 0.5–1.0 (this allows the density of the cells to increase
Nguyen et al. BMC Biochemistry
(2018) 19:12
at a much faster rate than if growing at the lower induction temperature), and then the temperature of the
growths dropped to the determined value. At the colder
temperatures, the length of time at which the cells are
grown has to be extended, and as such the available nutrients may be depleted, not producing enough soluble
protease. In general, E. coli growth in LB media stops at
relatively low cell densities because of the limited nutrients and carbon sources [34]. Therefore, a richer media
is preferred when growing at lower temperatures and for
a longer extended period of time, which helped improve
the amount of expression for all midgut proteases.
As a proof of principle, we proceeded to purify two
zymogen proteases one expressed at 23 °C (AaSPVII-NL)
and the other at 10 °C (AaLT-NL). With the observed
possible auto-activation of the proteases, we wanted to
ensure that halting and harvesting bacteria at an earlier
time-point before the presence of the active species,
would lead to successful purification and isolation of the
inactive zymogen. This would be especially problematic
for AaET, AaSPVI, and AaSPVII since auto-activation is
observed (Fig. 4), but not problematic for AaLT since no
auto-activation observed. We therefore, Nickel purified
AaSPVII-NL (cells harvested at 5 h post-induction) and
AaLT-NL (cells harvested at 48 h post-induction) to near
homogeneity utilizing a modified three-step gradient
approach to ensure separation of non-specific binding
of proteins and our proteases of interest. The his6-tag
was utilized in order to easily purify the proteases in
one step, which as seen in Fig. 6, was achieved. Since
the purification was done in the presence of DTT and
cold (4 °C) buffer conditions, no auto-activation of the
proteases was observed, even though the pH of the buffer was 7.2. Normally, this would be problematic since
eukaryotic trypsins have been shown to auto-activate
between pH 7 and 9 [30, 31]. Furthermore, to avoid any
further auto-activation of the purified AaSPVII-NL and
AaLT-NL zymogen proteases, buffer exchange dialysis
into Sodium Acetate buffer pH 5.2 and protein concentration under these conditions did not lead to precipitation
or loss of purified protease. More importantly, these
conditions prevented auto-activation of the AaSPVIINL zymogen protease. Work is currently underway to
purify the other midgut zymogen proteases. Once we
have isolated and purified all proteases, we will be able
to determine the mode of activation and compare the
kinetic parameters between solubly expressed recombinant proteases and the isolated refolded proteases
from [15].
Conclusions
The Ae. aegypti mosquito is an efficient biological vector capable of infecting more than one uninfected human host. The mosquito-borne viruses (Zika, Dengue,
Page 12 of 14
Yellow Fever, and Chikungunya) are easily transmitted
through the blood feeding behavior of the mosquito,
which is needed for the Ae. aegypti life cycle to continue. Midgut-specific proteases help digest blood meal
proteins to produce the nutrients required for the
gonotrophic cycle. With knockdown studies on three of
the most abundant proteases (leading to effects on fecundity), inhibition of these and other midgut proteases
may provide a new vector control strategy. However,
before validating these proteases as inhibitor targets,
further biochemical studies on the activation, activity,
and specificity of each protease is needed. To achieve
such goals, recombinant proteases must first be produced. The easiest and fastest system to produce recombinant protein is E. coli. However, the natural
cytoplasmic conditions of most bacterial strains are reducing, which lead to improper folding of proteases
dependent on disulfide bridges. Therefore, using a specialized strain of E. coli cells (SHuffle® T7 Competent
cells, NEB) with a more oxidizing cytoplasm, we have
been able to produce wild type (native) zymogen midgut proteases without the protein leader sequence. Furthermore, since bacterial expression has led to possible
auto-activation, we have shown that halting and harvesting cells before the presence of the active species,
can lead to the isolation and purification of the zymogens. The approach described here should provide researchers with a faster starting point to determine the
ideal conditions for recombinant protease expression
using E. coli as the host.
Additional files
Additional file 1: Figure S1. SDS-PAGE analysis and BApNA activity
assays of samples collected from the small-scale growth experiment
of AaET-NL non-induced SHuffle® E. coli cells (NEB) grown in TB
media at 15 °C. Samples were collected at the given time points (in
hours). The MW ladder is in kilo-Daltons (kDa). The gel shows both
the total and soluble samples collected at the same time-points as in
Fig. 4a There is no expression of AaET-NL zymogen. In addition, very
little to no BApNA activity is observed (plot on the right), similar to
the pre-induction (0 h) and early post-induction (3 h) sample in Fig.
4a. (DOCX 556 kb)
Additional file 2: Figure S2. SDS-PAGE analysis and BApNA activity
assays of samples collected from the small-scale growth experiment of
AaSPVI-NL non-induced SHuffle® E. coli cells (NEB) grown in TB media at
15 °C. Samples were collected at the given time points (in hours). The
MW ladder is in kilo-Daltons (kDa). The gel shows both the total and
soluble samples collected at the same time-points as in Fig. 4b. There is
no expression of AaSPVI-NL zymogen. In addition, very little to no BApNA
activity is observed (plot on the right), similar to the pre-induction (0 h) and
early post-induction (2 h) sample in Fig. 4b. (DOCX 1120 kb)
Additional file 3: Figure S3. SDS-PAGE analysis and BApNA activity
assays of samples collected from the small-scale growth experiment
of AaSPVII-NL non-induced SHuffle® E. coli cells (NEB) grown in TB
media at 15 °C. Samples were collected at the given time points (in
hours). The MW ladder is in kilo-Daltons (kDa). The gel shows both
the total and soluble samples collected at the same time-points as in
Fig. 4c There is no expression of AaSPVII-NL zymogen. In addition,
Nguyen et al. BMC Biochemistry
(2018) 19:12
very little to no BApNA activity is observed (plot on the right), similar
to the pre-induction (0 h) and early post-induction (4, 8, 10 h) samples in
Fig. 4c. (DOCX 746 kb)
Page 13 of 14
6.
7.
8.
Abbreviations
AaET: Aedes aegypti Early Trypsin; AaLT: Aedes aegypti Late Trypsin; AaSPVI: Aedes
aegypti Serine Protease VI; AaSPVII: Aedes aegypti Serine Protease VII; BApNA: Nαbenzoyl-D, L-arginine p-nitroanilide
Acknowledgements
The Rascón lab would like to thank the Dr. Roger L. Miesfeld lab, specifically
Dr. Jun Isoe for providing Ae. aegypti whole body and midgut cDNA. We
would also like to thank the first Chem 131B (Biochemistry Capstone
Lab Course) Fall 2013 students for helping with the initial design and
cloning of the mosquito midgut protease genes: James T. Nguyen,
Jonathan Fong, Anh Dai Nguyen, Radhakrishna Patel, Simon Du, Joselito
(Joe) Lopez, Frank Nguyen, Shital Patel, Justin Tran, and Ngoc (Tumi)
Tran, as well as others in the class. In addition, special thanks to Eliza
Vien for helping with initial growth experiments of AaSPVI.
9.
10.
11.
12.
13.
Funding
Research reported in this publication was supported by the National Institute
of General Medical Sciences (NIGMS) of the National Institutes of Health
(NIH) under Award Number SC3GM116681 to AAR. The content is solely the
responsibility of the authors and does not necessarily represent the official
views of the National Institutes of Health.
14.
15.
Availability of data and materials
Data is presented within this manuscript. However, materials (such as plasmid
constructs and purified enzyme) will not be available. This is part of work and
other projects that are ongoing in the Rascón lab.
Authors’ contributions
AAR designed research; JTN, DF, TF, RML, JMG, OEB, KP, and AAR performed
research; JTN, DF, TF, RML, and AAR analyzed data; AAR wrote the manuscript.
All authors read and approved the final manuscript.
16.
17.
18.
Ethics approval and consent to participate
Not applicable.
19.
Consent for publication
Not applicable.
20.
Competing interests
The authors declare that they have no competing interests.
21.
22.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
23.
Received: 16 February 2018 Accepted: 4 December 2018
24.
References
1. Isoe J, Rascon AA Jr, Kunz S, Miesfeld RL. Molecular genetic analysis of
midgut serine proteases in Aedes aegypti mosquitoes. Insect Biochem Mol
Biol. 2009;39(12):903–12.
2. Monath TP. Dengue and yellow fever–challenges for the development and
use of vaccines. N Engl J Med. 2007;357(22):2222–5.
3. Schwartz O, Albert ML. Biology and pathogenesis of chikungunya virus. Nat
Rev Microbiol. 2010;8(7):491–500.
4. Casale TB, Teng MN, Morano JP, Unnasch T, Lockwood CJ. Zika virus: an
emerging infectious disease with serious perinatal and neurologic
complications. J Allergy Clin Immunol. 2018;141(2):482–90.
5. Elizondo-Quiroga D, Medina-Sanchez A, Sanchez-Gonzalez JM, Eckert KA,
Villalobos-Sanchez E, Navarro-Zuniga AR, Sanchez-Tejeda G, CorreaMorales F, Gonzalez-Acosta C, Arias CF, et al. Zika virus in salivary
glands of five different species of wild-caught mosquitoes from
Mexico. Sci Rep. 2018;8(1):809.
25.
26.
27.
28.
29.
Kauffman EB, Kramer LD. Zika virus mosquito vectors: competence, biology,
and vector control. J Infect Dis. 2017;216(suppl_10):S976–90.
Li G, Teleki C, Wang T. Memory T Cells in Flavivirus Vaccination. Vaccines
(Basel). 2018;6(4). https://doi.org/10.3390/vaccines6040073.
Tharmarajah K, Mahalingam S, Zaid A. Chikungunya: vaccines and
therapeutics. F1000Res. 2017;6:2114.
Rosenbaum L. Trolleyology and the dengue vaccine dilemma. N Engl J
Med. 2018;379(4):305–7.
Larson HJ, Hartigan-Go K, de Figueiredo A. Vaccine confidence plummets in
the Philippines following dengue vaccine scare: why it matters to pandemic
preparedness. Hum Vaccin Immunother. 2018;12:1–3. https://doi.org/10.
1080/21645515.2018.1522468.
World Health Organization (WHO). (2018) Revised SAGE recommendation
on use of dengue vaccine. Retrieved from https://www.who.int/immunization/
diseases/dengue/revised_SAGE_recommendations_dengue_vaccines_apr2018/
en/. Accessed 4 Nov 2018.
Islam J, Zaman K, Tyagi V, Duarah S, Dhiman S, Chattopadhyay P. Protection
against mosquito vectors Aedes aegypti, Anopheles stephensi and Culex
quinquefasciatus using a novel insect repellent, ethyl anthranilate. Acta
Trop. 2017;174:56–63.
Scaraffia PY, Tan G, Isoe J, Wysocki VH, Wells MA, Miesfeld RL. Discovery of
an alternate metabolic pathway for urea synthesis in adult Aedes aegypti
mosquitoes. Proc Natl Acad Sci U S A. 2008;105(2):518–23.
Brandon MC, Pennington JE, Isoe J, Zamora J, Schillinger AS, Miesfeld RL.
TOR signaling is required for amino acid stimulation of early trypsin protein
synthesis in the midgut of Aedes aegypti mosquitoes. Insect Biochem Mol
Biol. 2008;38(10):916–22.
Rascon AA Jr, Gearin J, Isoe J, Miesfeld RL. In vitro activation and enzyme
kinetic analysis of recombinant midgut serine proteases from the dengue
vector mosquito Aedes aegypti. BMC Biochem. 2011;12:43.
Zhou G, Isoe J, Day WA, Miesfeld RL. Alpha-COPI coatomer protein is
required for rough endoplasmic reticulum whorl formation in mosquito
midgut epithelial cells. PLoS One. 2011;6(3):e18150.
Felix CR, Betschart B, Billingsley PF, Freyvogel TA. Post-feeding induction of
trypsin in the midgut of Aedes-Aegypti L (Diptera, Culicidae) is separable
into 2 cellular-phases. Insect Biochem. 1991;21(2):197–203.
Noriega FG, Pennington JE, Barillas-Mury C, Wang XY, Wells MA. Aedes
aegypti midgut early trypsin is post-transcriptionally regulated by blood
feeding. Insect Mol Biol. 1996;5(1):25–9.
Barillas-Mury C, Wells MA. Cloning and sequencing of the blood meal-induced
late trypsin gene from the mosquito Aedes aegypti and characterization of the
upstream regulatory region. Insect Mol Biol. 1993;2(1):7–12.
Rosano GL, Ceccarelli EA. Recombinant protein expression in Escherichia
coli: advances and challenges. Front Microbiol. 2014;5:172.
Lobstein J, Emrich CA, Jeans C, Faulkner M, Riggs P, Berkmen M. SHuffle, a
novel Escherichia coli protein expression strain capable of correctly folding
disulfide bonded proteins in its cytoplasm. Microb Cell Factories. 2012;11:56.
Petersen TN, Brunak S, von Heijne G, Nielsen H. SignalP 4.0:
discriminating signal peptides from transmembrane regions. Nat
Methods. 2011;8(10):785–6.
Arner ES, Holmgren A. Physiological functions of thioredoxin and
thioredoxin reductase. Eur J Biochem. 2000;267(20):6102–9.
Joseph BC, Pichaimuthu S, Srimeenakshi S. An overview of the parameters
for recombinant protein expression in Escherichia coli. J Cell Sci Ther.
2015;06(05):1.
Kaur J, Kumar A, Kaur J. Strategies for optimization of heterologous protein
expression in E. coli: roadblocks and reinforcements. Int J Biol Macromol.
2018;106:803–22.
Singh P, Sharma L, Kulothungan SR, Adkar BV, Prajapati RS, Ali PS, Krishnan
B, Varadarajan R. Effect of signal peptide on stability and folding of
Escherichia coli thioredoxin. PLoS One. 2013;8(5):e63442.
Krause M, Neubauer A, Neubauer P. The fed-batch principle for the
molecular biology lab: controlled nutrient diets in ready-made media
improve production of recombinant proteins in Escherichia coli. Microb
Cell Factories. 2016;15(1):110.
Singha TK, Gulati P, Mohanty A, Khasa YP, Kapoor RK, Kumar S. Efficient genetic
approaches for improvement of plasmid based expression of recombinant
protein in Escherichia coli : a review. Process Biochem. 2017;55:17–31.
Kalhok SE, Tabak LM, Prosser DE, Brook W, Downe AE, White BN. Isolation,
sequencing and characterization of two cDNA clones coding for trypsin-like
enzymes from the midgut of Aedes aegypti. Insect Mol Biol. 1993;2(2):71–9.
Nguyen et al. BMC Biochemistry
(2018) 19:12
30. Whitcomb DC, Lowe ME. Human pancreatic digestive enzymes. Dig Dis Sci.
2007;52(1):1–17.
31. Stroud RM, Kossiakoff AA, Chambers JL. Mechanisms of zymogen activation.
Annu Rev Biophys Bioeng. 1977;6:177–93.
32. Cheng G, Liu Y, Wang P, Xiao X. Mosquito defense strategies against viral
infection. Trends Parasitol. 2016;32(3):177–86.
33. Wingfield PT. Overview of the purification of recombinant proteins. Curr
Protoc Protein Sci. 2015;80(6):1 1–35.
34. Jia B, Jeon CO. High-throughput recombinant protein expression in
Escherichia coli: current status and future perspectives. Open Biol. 2016;6(8).
https://doi.org/10.1098/rsob.160196
35. Widmann M, Christen P. Comparison of folding rates of homologous
prokaryotic and eukaryotic proteins. J Biol Chem. 2000;275(25):18619–22.
36. Abita JP, Delaage M, Lazdunski M. The mechanism of activation of
trypsinogen. The role of the four N-terminal aspartyl residues. Eur J
Biochem. 1969;8(3):314–24.
37. Baneyx F, Mujacic M. Recombinant protein folding and misfolding in
Escherichia coli. Nat Biotechnol. 2004;22(11):1399–408.
Page 14 of 14
Purchase answer to see full
attachment
